Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions
XB-LINE-2282

Line Name: Xtr.sox2em2Horb


Summary
Synonym:
Species: Xenopus tropicalis
Background Strain: Xtr.Nigerian1NXR
Paternal Line:
Maternal Line:
Description: CRISPR knockout of sox2 (SRY-box 2). Custom mutant line. Germ line transmission confirmed. Animals carry a 1 base pair insertion. Contact the NXR for more information.
Phenotype Description: +1 base pair mutation sequence AACAACCAGAGTAAGAACAGCCCGG(A)ATAGAGTCAAGAGACCC. Associated with human syndromic microphthalmia 3.
Color Morph: pigmented
Breeding Type: OUTBRED
Lab of Origin: Horb Lab
Line Type: Mutant
Mutated Gene(s): sox2
MTA Required: No
Public: Yes
Catalogue Number: NXR_3174

Stock Center RRID Generation Availability Mutant Details
NXR (US) NXR_3174 F1 Order
EXRC (Europe)
NBRP (Japan)
XLRRI (US)

Back to Search Lines