|
XB-LINE-2282
Line Name: Xtr.sox2em2Horb
|
|
Summary | |
---|---|
Synonym: | |
Species: | Xenopus tropicalis |
Background Strain: | Xtr.Nigerian1NXR |
Paternal Line: | |
Maternal Line: | |
Description: | CRISPR knockout of sox2 (SRY-box 2). Custom mutant line. Germ line transmission confirmed. Animals carry a 1 base pair insertion. Contact the NXR for more information. |
Phenotype Description: | +1 base pair mutation sequence AACAACCAGAGTAAGAACAGCCCGG(A)ATAGAGTCAAGAGACCC. Associated with human syndromic microphthalmia 3. |
Color Morph: | pigmented |
Breeding Type: | OUTBRED |
Lab of Origin: | Horb Lab |
Line Type: | Mutant |
Mutated Gene(s): | sox2 |
MTA Required: | No |
Public: | Yes |
Catalogue Number: | NXR_3174 |
Stock Center | RRID | Generation | Availability | Mutant Details | |
---|---|---|---|---|---|
NXR (US) | NXR_3174 | F1 | Order | ||
EXRC (Europe) | |||||
NBRP (Japan) | |||||
XLRRI (US) |
Back to Search Lines