|
XB-LINE-2058
Line Name: Xtr.tyremOchi
|
|
Summary | |
---|---|
Synonym: | Xtr.tyrtmOchi |
Species: | Xenopus tropicalis |
Background Strain: | Xtr.Outbred |
Paternal Line: | |
Maternal Line: | |
Description: | An albino line with CRISPR/Cas9-targeted mutation in tyrosinase (tyr) gene, made by the Ochi Lab. The target sequence is in exon 1 [GGAAAGGAACATGGTCCCTC]. |
Phenotype Description: | |
Color Morph: | albino |
Breeding Type: | OUTBRED |
Lab of Origin: | Ochi Lab |
Line Type: | Mutant |
Mutated Gene(s): | tyr |
MTA Required: | Yes |
Public: | Yes |
Catalogue Number: | HUARC_2004 |
Stock Center | RRID | Generation | Availability | Mutant Details | Information |
---|---|---|---|---|---|
NXR (US) | |||||
EXRC (Europe) | |||||
NBRP (Japan) | HUARC_2004 | F1 | Order | adult male and females available | |
XLRRI (US) |
Back to Search Lines