|
XB-LINE-1856
Line Name: Xtr.runx1em3NXR
|
|
Summary | |
---|---|
Synonym: | |
Species: | Xenopus tropicalis |
Background Strain: | Xtr.Nigerian1NXR |
Paternal Line: | |
Maternal Line: | |
Description: | CRISPR knockout of runx1(runt related transcription factor 1). Germ line transmission confirmed. Animals carry a 1bp insertion in runx1 [plus1: CCCTCCACCACTCTGAGTTCCGGGGAAGATGAGCGAACCCATCCCG] |
Phenotype Description: | |
Color Morph: | pigmented |
Breeding Type: | OUTBRED |
Lab of Origin: | NXR |
Line Type: | Mutant |
Mutated Gene(s): | runx1 |
MTA Required: | No |
Public: | Yes |
Catalogue Number: | tbd |
Stock Center | RRID | Generation | Availability | Mutant Details | |
---|---|---|---|---|---|
NXR (US) | tbd | Adult | Order | contact NXR for availability | |
EXRC (Europe) | |||||
NBRP (Japan) | |||||
XLRRI (US) |
Back to Search Lines