Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-449
Mature Sequence: AGGCAGUGUAAUGUUAGCUGGU
Full Sequence:
miRBase:
In Situ Images:

NF Stage 10

NF Stage 10

NF Stage 18

NF Stage 26

NF Stage 40

NF Stage 40

Cited Literature:
MicroRNA-449 in cell fate determination.
Lizé M et al. 2011
Posttranscriptional activation of gene expression in Xenopus laevis oocytes by microRNA-protein complexes (microRNPs).
Mortensen RD et al. 2011
Control of vertebrate multiciliogenesis by miR-449 through direct repression of the Delta/Notch pathway.
Marcet B et al. 2011