Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-427
Mature Sequence: GAAAGUGCUUUCUGUUUUGGGCG
Full Sequence:
miRBase:
In Situ Images:

NF Stage 26

NF Stage 40

Cited Literature:
Abundant and dynamically expressed miRNAs, piRNAs, and other small RNAs in the vertebrate Xenopus tropicalis.
Armisen J et al. 2009
The miR-430/427/302 family controls mesendodermal fate specification via species-specific target selection.
Rosa A et al. 2009
Limiting Ago protein restricts RNAi and microRNA biogenesis during early development in Xenopus laevis.
Lund E et al. 2011
Substrate selectivity of exportin 5 and Dicer in the biogenesis of microRNAs.
Lund E et al. 2006
Stage-specific expression of microRNAs during Xenopus development.
Watanabe T et al. 2005
Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation.
Tang GQ et al. 2008
Deadenylation of maternal mRNAs mediated by miR-427 in Xenopus laevis embryos.
Lund E et al. 2009
RNAi in Xenopus: look before you leap.
Flynt AS et al. 2011