Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-34b
Mature Sequence: CAGGCAGUGUAGUUAGCUGAUUGU
Full Sequence:
miRBase:
In Situ Images:

NF Stage 20

NF Stage 43

NF Stage 45

NF Stage 9

Cited Literature:
The miR-30 miRNA family regulates Xenopus pronephros development and targets the transcription factor Xlim1/Lhx1.
Agrawal R et al. 2009
p53 and microRNA-34 are suppressors of canonical Wnt signaling.
Kim NH et al. 2011
Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation.
Tang GQ et al. 2008