Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-31
Mature Sequence: AGGCAAGAUGUUGGCAUAGCUG
Full Sequence:
miRBase:
In Situ Images:

NF Stage 32

NF Stage 38

NF Stage 40

Cited Literature:
Substrate selectivity of exportin 5 and Dicer in the biogenesis of microRNAs.
Lund E et al. 2006
miR-31 functions as a negative regulator of lymphatic vascular lineage-specific differentiation in vitro and vascular development in vivo.
Karpanen T et al. 2010
Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation.
Tang GQ et al. 2008
Exportin 5 is a RanGTP-dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs.
Bohnsack MT et al. 2004