Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-30a-5p
Mature Sequence: UGUAAACAUCCUCGACUGGAAG
Full Sequence:
miRBase:
In Situ Images:

NF Stage 29

NF Stage 32

NF Stage 40

Cited Literature:
The miR-30 miRNA family regulates Xenopus pronephros development and targets the transcription factor Xlim1/Lhx1.
Agrawal R et al. 2009