Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-27c
Mature Sequence: UUCACAGUGGCUAAGUUCCAC
Full Sequence:
miRBase:
In Situ Images:

NF Stage 30

NF Stage 40

NF Stage 45

Cited Literature:
Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation.
Tang GQ et al. 2008