Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-17-5p
Mature Sequence: CAAAGUGCUUACAGUGCAGGUAGU
Full Sequence:
miRBase:
In Situ Images:

NF Stage 16

NF Stage 16

NF Stage 28

NF Stage 35

Cited Literature:
Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation.
Tang GQ et al. 2008