Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-128
Mature Sequence: UCACAGUGAACCGGUCUCUUUU
Full Sequence:
miRBase:
In Situ Images:

NF Stage 29

NF Stage 36

NF Stage 42

NF Stage 42

Cited Literature:
Identification and expression-profiling of Xenopus tropicalis miRNAs including plant miRNA-like RNAs at metamorphosis.
et al. 2007
Identification of a microRNA that activates gene expression by repressing nonsense-mediated RNA decay.
Bruno IG et al. 2011