Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-125b
Mature Sequence: UCCCUGAGACCCUAACUUGUGA
Full Sequence:
miRBase:
In Situ Images:

NF Stage 28

NF Stage 35

NF Stage 42

NF Stage 42

Cited Literature:
Testis-derived microRNA profiles of African clawed frogs (Xenopus) and their sterile hybrids.
Michalak P et al. 2008
miR-31 functions as a negative regulator of lymphatic vascular lineage-specific differentiation in vitro and vascular development in vivo.
Karpanen T et al. 2010