Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29212816

gRNA Name: hs6st1 gRNA3
Synonyms: Hs6st1_cr_S2, hs6st1_S2 crRNA
Genomic Target: hs6st1

Sequence: 5' AGCTGTGTGCCGGGGGTACT 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 19/20 20/20 20/20
genome
gRNA
5' AGTACCCCTGGCACACAGCT 3'
   |||||||| |||||||||||
3' TCATGGGGGCCGTGTGTCGA 5'
5' AGTACCCCCGGCACACAGCT 3'
   ||||||||||||||||||||
3' TCATGGGGGCCGTGTGTCGA 5'
5' AGTACCCCCGGCACACAGCT 3'
   ||||||||||||||||||||
3' TCATGGGGGCCGTGTGTCGA 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr5L:144031371..144031390 20/20 Antisense target hs6st1.L
Chr5S:120943502..120943521 20/20 Antisense target hs6st1.S
Chr8L:887150..887169 17/20 Sense off-target LOC108698840
Chr3L:148427019..148427038 16/20 Sense off-target carm1p1.L
tropicalis 10.0 Chr5:133418288..133418307 19/20 Antisense target hs6st1
Chr8:1164222..1164241 17/20 Sense off-target cxxc1
Chr2:93282959..93282978 18/20 Antisense unknown
Publications
First: The heparan sulfate modification enzyme, Hs6st1, governs Xenopus neuroectodermal patterning by regulating distributions of Fgf and Noggin., Dev Biol 2023                            
Most recent:
View All Papers