Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29212814

gRNA Name: hs6st1 gRNA1
Synonyms: Hs6st1.L crRNA, Hs6st1_cr_L
Genomic Target: hs6st1

Sequence: 5' GCTCGGTCCAGTCGGCGTGG 3'



Genomic Target laevis.L laevis.S
Identities 20/20 20/20
genome
gRNA
5' CCACGCCGACTGGACCGAGC 3'
   ||||||||||||||||||||
3' GGTGCGGCTGACCTGGCTCG 5'
5' CCACGCCGACTGGACCGAGC 3'
   ||||||||||||||||||||
3' GGTGCGGCTGACCTGGCTCG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr5L:144031396..144031415 20/20 Sense target hs6st1.L
Chr5S:120943527..120943546 20/20 Sense target hs6st1.S
tropicalis 10.0 Chr8:67817675..67817694 18/20 Sense off-target hs6st2
Publications
First: The heparan sulfate modification enzyme, Hs6st1, governs Xenopus neuroectodermal patterning by regulating distributions of Fgf and Noggin., Dev Biol 2023                            
Most recent:
View All Papers