Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-29212801

Morpholino Name: sox18 MO2
Synonyms: xlsox18MO
Target mRNA: sox18

Morpholino Type: translation blocking morpholino
Sequence: 5' CAAGACATCTTATAAAACCTCACGG 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:40501684..40501708 22/25 Sense unknown
tropicalis 10.0 Chr4:113366635..113366659 21/25 Sense unknown
Chr5:69209259..69209283 21/25 Sense unknown
Publications
First: Mechanistic study of transcription factor Sox18 during heart development., Gen Comp Endocrinol 2024  
Most recent:
View All Papers