Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29209559

gRNA Name: wt1 gRNA2
Synonyms:
Genomic Target: wt1

Sequence: 5' TGGGGGTCTGGGTTCCAGGT 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 20/20 20/20
genome
gRNA
5' ACCTGGAACCCAGACCCCCA 3'
   ||||||||||||||||||||
3' TGGACCTTGGGTCTGGGGGT 5'
5' ACCTGGAACCCAGACCCCCA 3'
   ||||||||||||||||||||
3' TGGACCTTGGGTCTGGGGGT 5'
5' ACCTGGAACCCAGACCCCCA 3'
   ||||||||||||||||||||
3' TGGACCTTGGGTCTGGGGGT 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr4L:13621814..13621833 20/20 Antisense target wt1.L
Chr4S:10280544..10280563 20/20 Sense target wt1.S
Chr7L:58524697..58524716 20/20 Antisense off-target LOC121395443
Chr2L:1048772..1048791 16/20 Sense off-target agpat3.L
Chr5S:20445687..20445706 16/20 Antisense off-target plekhh2.S
Chr3L:149268009..149268028 18/20 Antisense unknown
tropicalis 10.0 Chr4:18823747..18823766 20/20 Antisense target wt1
Chr3:8755374..8755393 19/20 Sense off-target cecr2
Publications
First: Appropriate Amounts and Activity of the Wilms' Tumor Suppressor Gene, wt1, Are Required for Normal Pronephros Development of Xenopus Embryos., J Dev Biol 2022            
Most recent:
View All Papers