Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29209472

gRNA Name: zswim4 gRNA4
Synonyms:
Genomic Target: zswim4

Sequence: 5' GGATCTCAGCGCCAAGAAGG 3'



Genomic Target tropicalis laevis.L
Identities 20/20 19/20
genome
gRNA
5' CCTTCTTGGCGCTGAGATCC 3'
   ||||||||||||||||||||
3' GGAAGAACCGCGACTCTAGG 5'
5' CCTTCTTAGCGCTGAGATCC 3'
   ||||||| ||||||||||||
3' GGAAGAACCGCGACTCTAGG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr3L:150878115..150878134 19/20 Antisense target zswim4.L
Chr2L:51747236..51747255 16/20 Sense unknown
Chr9_10S:78221753..78221772 16/20 Antisense unknown
tropicalis 10.0 Chr3:141229118..141229137 20/20 Antisense target zswim4
Chr3:3100346..3100365 17/20 Sense off-target kiaa0930
Chr4:138460567..138460586 16/20 Sense off-target camk1
Publications
First: ZSWIM4 regulates embryonic patterning and BMP signaling by promoting nuclear Smad1 degradation., EMBO Rep 2024                                            
Most recent:
View All Papers