Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29209471

gRNA Name: zswim4 gRNA3
Synonyms:
Genomic Target: zswim4

Sequence: 5' GGTGCCCGGGCCTCAGCCCC 3'



Genomic Target tropicalis laevis.S
Identities 20/20 19/20
genome
gRNA
5' GGGGCTGAGGCCCGGGCACC 3'
   ||||||||||||||||||||
3' CCCCGACTCCGGGCCCGTGG 5'
5' GGGGCTCAGGCCCGGGCACC 3'
   |||||| |||||||||||||
3' CCCCGACTCCGGGCCCGTGG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr3S:126022784..126022803 19/20 Antisense target zswim4.S
Chr8S:63918618..63918637 16/20 Sense unknown
tropicalis 10.0 Chr3:141229161..141229180 20/20 Antisense target zswim4
Publications
First: ZSWIM4 regulates embryonic patterning and BMP signaling by promoting nuclear Smad1 degradation., EMBO Rep 2024                                            
Most recent:
View All Papers