Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29209470

gRNA Name: zswim4 gRNA5
Synonyms:
Genomic Target: zswim4

Sequence: 5' GGCCCCCAAGAGAAGGTGCC 3'



Genomic Target tropicalis laevis.S
Identities 20/20 18/20
genome
gRNA
5' GGCACCTTCTCTTGGGGGCC 3'
   ||||||||||||||||||||
3' CCGTGGAAGAGAACCCCCGG 5'
5' GGCACCTTCTCTTTGGGGCG 3'
   ||||||||||||| ||||| 
3' CCGTGGAAGAGAACCCCCGG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr3S:126022798..126022817 18/20 Antisense target zswim4.S
Chr1L:90875384..90875403 17/20 Sense off-target rasgef1b.L
Chr9_10S:89883632..89883651 17/20 Sense off-target LOC108702303
Chr2L:180814479..180814498 18/20 Antisense unknown
Chr5L:125182960..125182979 17/20 Antisense unknown
tropicalis 10.0 Chr3:141229175..141229194 20/20 Antisense target zswim4
Chr6:72107389..72107408 18/20 Sense off-target slc9a3
Chr5:153036327..153036346 18/20 Sense off-target LOC100486435
Chr5:10690442..10690461 17/20 Sense off-target eprs1
Chr6:136836226..136836245 17/20 Sense off-target rad21
Chr2:40798291..40798310 16/20 Antisense off-target pola1
Chr4:75037010..75037029 16/20 Sense off-target sf3b3
Chr3:103965903..103965922 16/20 Antisense off-target cep152
Chr8:12387262..12387281 16/20 Antisense off-target nup214
Chr2:118184889..118184908 16/20 Sense off-target fam155a
Chr3:129794595..129794614 16/20 Sense off-target slc39a14
Chr4:90361364..90361383 18/20 Sense unknown
Chr1:30223338..30223357 16/20 Sense unknown
Chr6:40491757..40491776 16/20 Antisense unknown
Publications
First: ZSWIM4 regulates embryonic patterning and BMP signaling by promoting nuclear Smad1 degradation., EMBO Rep 2024                                            
Most recent:
View All Papers