Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29209469

gRNA Name: zswim4 gRNA2
Synonyms:
Genomic Target: zswim4

Sequence: 5' GGGCCTCAGCCCCAGGTACC 3'



Genomic Target tropicalis
Identities 20/20
genome
gRNA
5' GGTACCTGGGGCTGAGGCCC 3'
   ||||||||||||||||||||
3' CCATGGACCCCGACTCCGGG 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr3L:45967719..45967738 18/20 Sense off-target arhgap26.L
Chr8S:27684899..27684918 18/20 Sense off-target LOC108699886
tropicalis 10.0 Chr3:141229154..141229173 20/20 Antisense target zswim4
Chr3:117365301..117365320 17/20 Sense unknown
Publications
First: ZSWIM4 regulates embryonic patterning and BMP signaling by promoting nuclear Smad1 degradation., EMBO Rep 2024                                            
Most recent:
View All Papers