Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29209468

gRNA Name: zswim4 gRNA1
Synonyms:
Genomic Target: zswim4

Sequence: 5' GCCCCCAAGAGAAGGTGCCC 3'



Genomic Target tropicalis laevis.S
Identities 20/20 19/20
genome
gRNA
5' GGGCACCTTCTCTTGGGGGC 3'
   ||||||||||||||||||||
3' CCCGTGGAAGAGAACCCCCG 5'
5' GGGCACCTTCTCTTTGGGGC 3'
   |||||||||||||| |||||
3' CCCGTGGAAGAGAACCCCCG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr3S:126022797..126022816 19/20 Antisense target zswim4.S
Chr1L:90875385..90875404 18/20 Sense off-target rasgef1b.L
Chr9_10S:89883633..89883652 17/20 Sense off-target LOC108702303
Chr1L:74594090..74594109 18/20 Antisense unknown
Chr5L:125182959..125182978 18/20 Antisense unknown
Chr1S:153725845..153725864 16/20 Sense unknown
tropicalis 10.0 Chr3:141229174..141229193 20/20 Antisense target zswim4
Chr6:72107390..72107409 19/20 Sense off-target slc9a3
Chr6:136836227..136836246 18/20 Sense off-target rad21
Chr5:10690443..10690462 17/20 Sense off-target eprs1
Chr5:153036328..153036347 17/20 Sense off-target LOC100486435
Chr2:40798290..40798309 16/20 Antisense off-target pola1
Chr4:75037011..75037030 16/20 Sense off-target sf3b3
Chr3:103965902..103965921 16/20 Antisense off-target cep152
Chr8:12387261..12387280 16/20 Antisense off-target nup214
Chr2:118184890..118184909 16/20 Sense off-target fam155a
Chr3:129794596..129794615 16/20 Sense off-target slc39a14
Chr4:90361365..90361384 19/20 Sense unknown
Chr1:30223339..30223358 16/20 Sense unknown
Chr6:40491756..40491775 16/20 Antisense unknown
Publications
First: ZSWIM4 regulates embryonic patterning and BMP signaling by promoting nuclear Smad1 degradation., EMBO Rep 2024                                            
Most recent:
View All Papers