Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29209415

gRNA Name: bcan gRNA1
Synonyms:
Genomic Target: bcan

Sequence: 5' CTTGGCAACCCCTCTCTATAGTGTGGGAAGGGACTGATACAGAGGAGGGGGA TTGGAAGGATGGTCTGTATTTCCTAGGATTTGCCTACCAAGGGCTGAATCTATCATTACATTATTTAATGTTGGCTGCATCACAGCCTGA TATATGTATAAGAGTCTCCCAGAAGGGGGAAAGAGACTATAGTAGGACATAAAGTCAGCACTGCAAGCTCTGTACTTCTAACTGCCGGCT AAGCTGGTGGCACTAGGATACGAGAGAGAGGAGAAAACTCTGCATTTCACCTCTGCATTGACTACTGCACCATCGACCAGAGCCTGCAGA GAAAGAGAGAGAGAGCAAAGACTCTAAAGTTCTTTTCCGCTGTCATCCTATCCCATATCCAGGACACA 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 48/394 48/394 52/394
genome
gRNA
5' CCCCCTTTCTCTGTATTAGTCCCTTCCCACACTATAGAGAGGGGTTGCCAAG 3'
    |||| | |||||||| |||||||||||||||||||||||||||||||||||
3' AGGGGGAGGAGACATAGTCAGGGAAGGGTGTGATATCTCTCCCCAACGGTTC 5'
5' CCCCCCCACCCTGTATCAGTCCCTTCCCACACTATAGAGAGGGGTTGCCAAG 3'
    |||||  | ||||||||||||||||||||||||||||||||||||||||||
3' AGGGGGAGGAGACATAGTCAGGGAAGGGTGTGATATCTCTCCCCAACGGTTC 5'
5' TCCCCCTCCTCTGTATCAGTCCCTTCCCACACTATAGAGAGGGGTTGCCAAG 3'
   ||||||||||||||||||||||||||||||||||||||||||||||||||||
3' AGGGGGAGGAGACATAGTCAGGGAAGGGTGTGATATCTCTCCCCAACGGTTC 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr8S:97862126..97862177 52/52 Sense target bcan.S
Chr8L:123698629..123698680 48/52 Sense target bcan.L
tropicalis 10.0 Chr8:132588390..132588441 48/52 Sense target bcan
Publications
First: A CRISPR-Cas9-mediated versatile method for targeted integration of a fluorescent protein gene to visualize endogenous gene expression in Xenopus laevis., Dev Biol 2024                                  
Most recent:
View All Papers