Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29209270

gRNA Name: chst3 gRNA1
Synonyms:
Genomic Target: chst3

PAM Sequence: NGG
Sequence: 5' CCTCGTCGACATATACTCCTCAT 3'



Genomic Target tropicalis laevis.L
Identities 23/23 22/23
genome
gRNA
5' ATGAGGAGTATATGTCGACGAGG 3'
   |||||||||||||||||||||||
3' TACTCCTCATATACAGCTGCTCC 5'
5' ATGAGGAGAATATGTCGACGAGG 3'
   |||||||| ||||||||||||||
3' TACTCCTCATATACAGCTGCTCC 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr7L:43978237..43978259 22/23 Antisense target chst3.L
tropicalis 10.0 Chr7:45979230..45979252 23/23 Antisense target chst3
Publications
First: Tissue-specific expression of carbohydrate sulfotransferases drives keratan sulfate biosynthesis in the notochord and otic vesicles of Xenopus embryos., Front Cell Dev Biol 2023                                            
Most recent:
View All Papers