Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29209269

gRNA Name: chst1 gRNA3
Synonyms:
Genomic Target: chst1

PAM Sequence: NGG
Sequence: 5' ATTTTGGCGACGACCCGCAGCGG 3'



Genomic Target tropicalis
Identities 23/23
genome
gRNA
5' CCGCTGCGGGTCGTCGCCAAAAT 3'
   |||||||||||||||||||||||
3' GGCGACGCCCAGCAGCGGTTTTA 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr9_10L:24966767..24966789 20/23 Sense unknown
tropicalis 10.0 Chr4:13783985..13784007 23/23 Sense target chst1
Publications
First: Tissue-specific expression of carbohydrate sulfotransferases drives keratan sulfate biosynthesis in the notochord and otic vesicles of Xenopus embryos., Front Cell Dev Biol 2023                                            
Most recent:
View All Papers