Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29209268

gRNA Name: chst1 gRNA1
Synonyms:
Genomic Target: chst1

PAM Sequence: NGG
Sequence: 5' CCTGATCGTCGAGTTATGTTGGG 3'



Genomic Target tropicalis laevis.S
Identities 23/23 21/23
genome
gRNA
5' CCCAACATAACTCGACGATCAGG 3'
   |||||||||||||||||||||||
3' GGGTTGTATTGAGCTGCTAGTCC 5'
5' CCCAACATAACTCGTCGATCAGA 3'
   |||||||||||||| ||||||| 
3' GGGTTGTATTGAGCTGCTAGTCC 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr4S:13990263..13990285 21/23 Antisense target chst1.S
Chr1S:109431300..109431322 19/23 Antisense unknown
Chr3L:37606820..37606842 19/23 Antisense unknown
Chr8L:32686434..32686456 19/23 Antisense unknown
Chr9_10S:87960261..87960283 19/23 Antisense unknown
tropicalis 10.0 Chr4:13784123..13784145 23/23 Sense target chst1
Publications
First: Tissue-specific expression of carbohydrate sulfotransferases drives keratan sulfate biosynthesis in the notochord and otic vesicles of Xenopus embryos., Front Cell Dev Biol 2023                                            
Most recent:
View All Papers