Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29209138

gRNA Name: cfap45 gRNA1
Synonyms: cfap45 CRISPR#1
Genomic Target: cfap45

Sequence: 5' GTCGCACAGAAGAACCCCAACGG 3'



Genomic Target tropicalis
Identities 23/23
genome
gRNA
5' CCGTTGGGGTTCTTCTGTGCGAC 3'
   |||||||||||||||||||||||
3' GGCAACCCCAAGAAGACACGCTG 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
tropicalis 10.0 Chr8:138470428..138470450 23/23 Sense target cfap45
Chr5:13639061..13639083 19/23 Sense unknown
Publications
First: CFAP45, a heterotaxy and congenital heart disease gene, affects cilia stability., Dev Biol 2023                                
Most recent:
View All Papers