Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-29209041

Morpholino Name: ssbp2 MO1
Synonyms:
Target mRNA: ssbp2

Morpholino Type: uncategorized morpholino
Sequence: 5' TTACTCTTGCCTTTGGCGTACATGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' GCATGTACGCCAAAGGCAAGAGTAA 3'
   |||||||||||||||||||||||||
3' CGTACATGCGGTTTCCGTTCTCATT 5'
5' GCATGTACGCCAAAGGCAAGAGTAA 3'
   |||||||||||||||||||||||||
3' CGTACATGCGGTTTCCGTTCTCATT 5'
5' GCATGTACGCCAAAGGCAAGAGTAA 3'
   |||||||||||||||||||||||||
3' CGTACATGCGGTTTCCGTTCTCATT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:197725284..197725308 25/25 Antisense target ssbp2.L
Chr1S:169984228..169984252 25/25 Antisense target ssbp2.S
Chr4L:99700709..99700733 21/25 Antisense off-target abca4.L
tropicalis 10.0 Chr1:181743252..181743276 25/25 Antisense target ssbp2
Publications
First: Xenopus Ssbp2 is required for embryonic pronephros morphogenesis and terminal differentiation., Sci Rep 2023                                            
Most recent:
View All Papers