Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29209040

gRNA Name: ccdc69 gRNA1
Synonyms:
Genomic Target: ccdc69

Sequence: 5' GCAGCTAATACGACTCACTATAGGAGAGAAATCTGGTGCTAGGTTTTAGAGCTAGAAATA 3'



Genomic Target
Identities
genome
gRNA
     
Genomic Alignments Position Identity Strand Target Genomic Target
Publications
First: Functional dissection and assembly of a small, newly evolved, W chromosome-specific genomic region of the African clawed frog Xenopus laevis., PLoS Genet 2023                            
Most recent:
View All Papers