Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29209017

gRNA Name: capn2 gRNA2
Synonyms:
Genomic Target: capn2

Sequence: 5' ACTCGGACTGATATCTGCCA 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 19/20 20/20 18/20
genome
gRNA
5' TGGCAGATATCAGTGCGAGT 3'
   |||||||||||||| |||||
3' ACCGTCTATAGTCAGGCTCA 5'
5' TGGCAGATATCAGTCCGAGT 3'
   ||||||||||||||||||||
3' ACCGTCTATAGTCAGGCTCA 5'
5' TGGCAGATATCAGTCCTTGT 3'
   ||||||||||||||||  ||
3' ACCGTCTATAGTCAGGCTCA 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr5L:17066709..17066728 20/20 Sense target capn2.L
Chr5S:12852482..12852501 18/20 Antisense target capn2.S
Chr1S:189563345..189563364 18/20 Sense off-target malt1.S
Chr2L:4051303..4051322 18/20 Sense off-target lsamp.L
Chr8L:98374100..98374119 17/20 Antisense unknown
Chr1S:152342353..152342372 16/20 Antisense unknown
Chr5L:79215909..79215928 16/20 Sense unknown
tropicalis 10.0 Chr5:9051272..9051291 19/20 Antisense target capn2
Chr8:93081685..93081704 17/20 Antisense off-target sav1
Chr7:14383298..14383317 17/20 Antisense off-target pcdh15
Chr5:111907463..111907482 18/20 Antisense unknown
Publications
First: Rare variants in CAPN2 increase risk for isolated hypoplastic left heart syndrome., HGG Adv 2023              
Most recent:
View All Papers