Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29209016

gRNA Name: capn2 gRNA1
Synonyms:
Genomic Target: capn2

Sequence: 5' GTACTCAAGCAAAACCCAAG 3'



Genomic Target laevis.L laevis.S
Identities 20/20 18/20
genome
gRNA
5' CTTGGGTTTTGCTTGAGTAC 3'
   ||||||||||||||||||||
3' GAACCCAAAACGAACTCATG 5'
5' CTTGGGTTTTGCTTGAGTGT 3'
   ||||||||||||||||||  
3' GAACCCAAAACGAACTCATG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr5L:17056180..17056199 20/20 Sense target capn2.L
Chr5S:12861331..12861350 18/20 Antisense target capn2.S
Chr5L:21953542..21953561 16/20 Sense off-target LOC108716513
Chr7S:4161373..4161392 16/20 Antisense off-target LOC108697331
Chr3L:20850699..20850718 18/20 Antisense unknown
Chr1S:153714303..153714322 17/20 Sense unknown
Chr5L:132671995..132672014 16/20 Sense unknown
tropicalis 10.0 Chr7:27362710..27362729 17/20 Sense off-target adgra1
Publications
First: Rare variants in CAPN2 increase risk for isolated hypoplastic left heart syndrome., HGG Adv 2023              
Most recent:
View All Papers