Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-29208970

Morpholino Name: hdac3 MO1
Synonyms: HDAC3.S morpholino
Target mRNA: hdac3

Morpholino Type: translation blocking morpholino
Sequence: 5' TCTTTGCCATTTCGCTGCCACAGAC 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' GTCTGTGGCAGCGAAATGGCAAAGA 3'
   |||||||||||||||||||||||||
3' CAGACACCGTCGCTTTACCGTTTCT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:119483240..119483264 25/25 Antisense target hdac3.S
Chr3S:895741..895765 21/25 Sense off-target sox5.S
Chr6S:117474015..117474039 21/25 Sense off-target ncald.S
Publications
First: HDAC3 But not HDAC2 Mediates Visual Experience-Dependent Radial Glia Proliferation in the Developing Xenopus Tectum., Front Cell Neurosci 2016                
Most recent: BAP1 regulates epigenetic switch from pluripotency to differentiation in developmental lineages giving rise to BAP1-mutant cancers., Sci Adv 2019          
View All Papers