Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29208592

gRNA Name: cbs gRNA1
Synonyms:
Genomic Target: cbs

PAM Sequence: TGC
Sequence: 5' CCGTCCTGCCGACAGTGAGCTGC 3'



Genomic Target tropicalis laevis.L
Identities 23/23 20/23
genome
gRNA
5' GCAGCTCACTGTCGGCAGGACGG 3'
   |||||||||||||||||||||||
3' CGTCGAGTGACAGCCGTCCTGCC 5'
5' ACAGCTCACTGTCGGGAGAACGG 3'
    |||||||||||||| || ||||
3' CGTCGAGTGACAGCCGTCCTGCC 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr2L:320546..320568 20/23 Antisense target cbs.L
Chr1L:14439153..14439175 20/23 Sense off-target ptpre.L
Chr5L:105393551..105393573 20/23 Antisense off-target abcc5.L
Chr4S:32502833..32502855 20/23 Antisense off-target LOC108714959
Chr1L:50991332..50991354 20/23 Sense unknown
Chr3S:40730505..40730527 20/23 Sense unknown
Chr7L:123805348..123805370 20/23 Sense unknown
Chr9_10L:33192761..33192783 20/23 Antisense unknown
tropicalis 10.0 Chr2:339280..339302 23/23 Antisense target cbs
Chr3:125035943..125035965 20/23 Antisense off-target astl
Chr10:16637057..16637079 19/23 Sense off-target cyb561
Publications
First:
Most recent:
View All Papers