Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29208326

gRNA Name: zyx gRNA3
Synonyms:
Genomic Target: zyx

PAM Sequence: TGG
Sequence: 5' GGTTGTGACCCAGATCCACC 3'



Genomic Target
Identities
genome
gRNA
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr7S:347679..347698 16/20 Sense off-target sorcs1.S
Chr1L:157769910..157769929 16/20 Antisense unknown
Chr7L:134914719..134914738 16/20 Antisense unknown
Publications
First:
Most recent:
View All Papers