Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-29208194

Morpholino Name: fadd MO1
Synonyms:
Target mRNA: fadd

Morpholino Type: uncategorized morpholino
Sequence: 5' GAGCAGCATGACTTGCAGATCCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25 25/25
genome
MO
5' CATGGATCTGCAAGTCACGCTGCTC 3'
   ||||||||||||||||| |||||||
3' GTACCTAGACGTTCAGTACGACGAG 5'
5' CATGGATTTGCAAGTCATGCTGCTC 3'
   ||||||| |||||||||||||||||
3' GTACCTAGACGTTCAGTACGACGAG 5'
5' CATGGATCTGCAAGTCATGCTGCTC 3'
   |||||||||||||||||||||||||
3' GTACCTAGACGTTCAGTACGACGAG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4S:13529443..13529467 25/25 Antisense target fadd.S
Chr4L:10615613..10615637 24/25 Antisense target fadd.L
Chr4S:13529443..13529467 25/25 Antisense off-target LOC108715237
Chr8L:67695178..67695202 21/25 Sense off-target LOC108698945
tropicalis 10.0 Chr4:14469033..14469057 24/25 Antisense target fadd
Chr3:119446924..119446948 21/25 Antisense unknown
Publications
First: Multiple functions of FADD in apoptosis, NF-κB-related signaling, and heart development in Xenopus embryos., Genes Cells 2012                                    
Most recent:
View All Papers