Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-29191136

Morpholino Name: hells MO1
Synonyms:
Target mRNA: hells

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCTCTGTCCCACAGGCATCTTATA 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 25/25 21/25
genome
MO
5' TATAAGATGCCTGTGGGACAGAGCT 3'
   |||||||||||||||||||||||||
3' ATATTCTACGGACACCCTGTCTCGA 5'
5' TGCAGCATGCCTGTGGGACAGAGCT 3'
   |  |  |||||||||||||||||||
3' ATATTCTACGGACACCCTGTCTCGA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:36564310..36564334 25/25 Antisense target hells.L
Chr7S:29019194..29019218 21/25 Sense target hells.S
Chr2S:99001855..99001879 21/25 Antisense off-target dmd.1.S
Chr7S:29019194..29019218 21/25 Sense off-target LOC108697620
Chr7S:29107591..29107615 21/25 Sense off-target LOC121396270
Chr8S:58741093..58741117 21/25 Sense unknown
Chr7L:101491737..101491761 21/25 Sense unknown
Chr7L:18661631..18661655 21/25 Antisense unknown
Publications
First: Lsh Is Essential for Maintaining Global DNA Methylation Levels in Amphibia and Fish and Interacts Directly with Dnmt1., Biomed Res Int 2015                          
Most recent:
View All Papers