Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29071414

gRNA Name: ric1 gRNA2
Synonyms: ric1.S CR
Genomic Target: ric1

Sequence: 5' TTCGTAGTCATAGTTGGATG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 19/20 20/20
genome
gRNA
5' CATCCAACTATGACTACGAA 3'
   ||||||||||||||||||||
3' GTAGGTTGATACTGATGCTT 5'
5' CATCCAACTATGACCACGAA 3'
   |||||||||||||| |||||
3' GTAGGTTGATACTGATGCTT 5'
5' CATCCAACTATGACTACGAA 3'
   ||||||||||||||||||||
3' GTAGGTTGATACTGATGCTT 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr1S:116407108..116407127 20/20 Antisense target ric1.S
Chr1L:137355781..137355800 19/20 Antisense target ric1.L
Chr2S:69415862..69415881 17/20 Sense off-target pum1.S
Chr7L:30037286..30037305 17/20 Sense off-target LOC108696168
Chr8L:105315171..105315190 18/20 Sense unknown
tropicalis 10.0 Chr1:126941851..126941870 20/20 Antisense target ric1
Publications
First: Genome-wide analysis of copy-number variation in humans with cleft lip and/or cleft palate identifies COBLL1, RIC1, and ARHGEF38 as clefting genes., Am J Hum Genet 2023                            
Most recent:
View All Papers