Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29071412

gRNA Name: cobll1 gRNA2
Synonyms: cobll1.S CR
Genomic Target: cobll1

Sequence: 5' TGCATGGTCGAGACACAACTG 3'



Genomic Target
Identities
genome
gRNA
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr9_10S:64410686..64410706 21/21 Antisense off-target LOC108702973
Publications
First: Genome-wide analysis of copy-number variation in humans with cleft lip and/or cleft palate identifies COBLL1, RIC1, and ARHGEF38 as clefting genes., Am J Hum Genet 2023                            
Most recent:
View All Papers