Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29071411

gRNA Name: cobll1 gRNA1
Synonyms: cobll1.L CR
Genomic Target: cobll1

Sequence: 5' GAGCATCGGTTTGCUUAATAA 3'



Genomic Target laevis.L
Identities 19/21
genome
gRNA
5' TTATTAAGCAAACCGATGCTC 3'
   |||||  ||||||||||||||
3' AATAAUUCGTTTGGCTACGAG 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr9_10L:73423589..73423609 19/21 Sense target cobll1.L
Chr2S:145556360..145556380 17/21 Sense unknown
Publications
First: Genome-wide analysis of copy-number variation in humans with cleft lip and/or cleft palate identifies COBLL1, RIC1, and ARHGEF38 as clefting genes., Am J Hum Genet 2023                            
Most recent:
View All Papers