Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-29071291

gRNA Name: dnmbp gRNA1
Synonyms:
Genomic Target: dnmbp

PAM Sequence: TGG
Sequence: 5' GGGAGCGCTCCTGGTTCATGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 18/21 19/21 19/21
genome
gRNA
5' CCATGAACCAGGAGCGCTGTG 3'
   ||||||||||||||||||   
3' GGTACTTGGTCCTCGCGAGGG 5'
5' CCATGAACCAGGAGCGCTCTG 3'
   |||||||||||||||||||  
3' GGTACTTGGTCCTCGCGAGGG 5'
5' CCATGAACCAGGAGCGCTCTG 3'
   |||||||||||||||||||  
3' GGTACTTGGTCCTCGCGAGGG 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr7L:31683901..31683921 19/21 Sense target dnmbp.L
Chr7S:25960393..25960413 19/21 Antisense target dnmbp.S
Chr7S:25960393..25960413 19/21 Antisense off-target LOC108697464
Chr8L:27198770..27198790 17/21 Sense off-target dgkk.L
Chr1S:151242448..151242468 17/21 Sense off-target atxn2.S
Chr2L:71659072..71659092 17/21 Sense unknown
tropicalis 10.0 Chr7:35532771..35532791 18/21 Sense target dnmbp
Chr9:46396801..46396821 19/21 Sense unknown
Publications
First: Dynamin Binding Protein Is Required for Xenopus laevis Kidney Development., Front Physiol 2019                                  
Most recent:
View All Papers