Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-25919054

gRNA Name: hmga2 gRNA1
Synonyms: hmga2 CR1
Genomic Target: hmga2

Sequence: 5' CGGAGCAACCTGCATCCCCC 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 19/20 19/20
genome
gRNA
5' GGGGGATGCAGGTTGCTCCG 3'
   ||||||||||||||||||||
3' CCCCCTACGTCCAACGAGGC 5'
5' GGGGGATGCAGGTTGCTCCA 3'
   ||||||||||||||||||| 
3' CCCCCTACGTCCAACGAGGC 5'
5' GGGGGATGCAGGTTGCTCCA 3'
   ||||||||||||||||||| 
3' CCCCCTACGTCCAACGAGGC 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr3L:64405612..64405631 19/20 Antisense target hmga2.L
Chr3S:90279145..90279164 19/20 Sense target hmga2.S
Chr4L:87000242..87000261 19/20 Antisense off-target ccdc24.L
Chr8L:132160984..132161003 19/20 Sense off-target pex11b.L
Chr7L:16031359..16031378 19/20 Sense off-target jakmip3.L
Chr1L:204312087..204312106 19/20 Antisense off-target LOC108718091
Chr1S:150438639..150438658 18/20 Sense off-target setd1b.S
Chr3L:37959005..37959024 18/20 Antisense off-target fam13b.L
Chr2L:6872921..6872940 18/20 Antisense off-target LOC108707828
Chr7L:130782778..130782797 18/20 Antisense off-target LOC108695970
Chr1L:115702883..115702902 17/20 Sense off-target ssbp4.L
Chr1S:96536933..96536952 17/20 Sense off-target ssbp4.S
Chr4L:141910493..141910512 17/20 Sense off-target foxp1.L
Chr4L:95134742..95134761 17/20 Antisense off-target dab2ip.L
Chr4L:112841455..112841474 17/20 Sense off-target septin3.L
Chr4L:95134742..95134761 17/20 Antisense off-target LOC121403061
Chr9_10L:22423031..22423050 16/20 Antisense off-target LOC108704334
Chr6L:10856864..10856883 20/20 Antisense unknown
Chr1L:57506268..57506287 19/20 Sense unknown
Chr3L:123197186..123197205 19/20 Sense unknown
Chr9_10L:100332188..100332207 19/20 Sense unknown
Chr9_10L:9059764..9059783 19/20 Antisense unknown
Chr4L:11910074..11910093 18/20 Antisense unknown
Chr6S:15772060..15772079 18/20 Antisense unknown
Chr5S:21535420..21535439 16/20 Antisense unknown
tropicalis 10.0 Chr3:57496616..57496635 20/20 Antisense target hmga2
Chr9:82708640..82708659 18/20 Antisense off-target wnt10a
Chr1:106157740..106157759 17/20 Sense off-target ssbp4
Chr3:116598132..116598151 19/20 Antisense unknown
Publications
First: Mink1 regulates spemann organizer cell fate in the xenopus gastrula via Hmga2., Dev Biol 2023                              
Most recent:
View All Papers