Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-25919048

Morpholino Name: maea MO1
Synonyms:
Target mRNA: maea

Morpholino Type: uncategorized morpholino
Sequence: 5' TGATTCCTGGACCGCCATCTTGGAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genome
MO
5' AGCCAAGATGGCGGTCCAGGAATCA 3'
   | |||||||||||||||||||||||
3' TAGGTTCTACCGCCAGGTCCTTAGT 5'
5' ATCCAAGATGGCGGTCCAGGAATCA 3'
   |||||||||||||||||||||||||
3' TAGGTTCTACCGCCAGGTCCTTAGT 5'
5' ATCCAAGATGGCGGTCCAGGAATCA 3'
   |||||||||||||||||||||||||
3' TAGGTTCTACCGCCAGGTCCTTAGT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:20203960..20203984 25/25 Antisense target maea.L
Chr1S:10946251..10946275 25/25 Antisense target maea.S
tropicalis 10.0 Chr1:19581885..19581909 24/25 Antisense target maea
Publications
First: maea affects head formation through ß-catenin degradation during early Xenopus laevis development., Dev Growth Differ 2023                    
Most recent:
View All Papers