Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-25918747

gRNA Name: cacna1c gRNA1
Synonyms:
Genomic Target: cacna1c

Sequence: 5' GCAGACGGGGGCAGCGCCATTGG 3'



Genomic Target laevis.L laevis.S
Identities 22/23 22/23
genome
gRNA
5' CCAATGGCGCTGCCCCCATCTGC 3'
   ||||||||||||||||| |||||
3' GGTTACCGCGACGGGGGCAGACG 5'
5' CCAATGGCGCTGCCCCCATCTGC 3'
   ||||||||||||||||| |||||
3' GGTTACCGCGACGGGGGCAGACG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr3L:14023737..14023759 22/23 Sense target cacna1c.L
Chr3S:5437461..5437483 22/23 Antisense target cacna1c.S
Chr6S:54797491..54797513 19/23 Sense off-target septin7.S
Publications
First: Membrane potential drives the exit from pluripotency and cell fate commitment via calcium and mTOR., Nat Commun 2022                                              
Most recent:
View All Papers