Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-25900621

gRNA Name: cacna1g gRNA1
Synonyms:
Genomic Target: cacna1g

Sequence: 5' GGTTAATGGCTCTCAGCGGGCGG 3'



Genomic Target tropicalis laevis.L
Identities 23/23 21/23
genome
gRNA
5' CCGCCCGCTGAGAGCCATTAACC 3'
   |||||||||||||||||||||||
3' GGCGGGCGACTCTCGGTAATTGG 5'
5' CCGCCCACTGAGAGCCATTAACA 3'
   |||||| ||||||||||||||| 
3' GGCGGGCGACTCTCGGTAATTGG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr9_10L:46199802..46199824 21/23 Antisense target cacna1g.L
Chr9_10S:38642666..38642688 21/23 Antisense off-target LOC108702791
Chr2L:90545085..90545107 19/23 Antisense unknown
tropicalis 10.0 Chr10:43778282..43778304 23/23 Antisense target cacna1g
Publications
First: Membrane potential drives the exit from pluripotency and cell fate commitment via calcium and mTOR., Nat Commun 2022                                              
Most recent:
View All Papers