Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-25900620

gRNA Name: kcnh6 gRNA2
Synonyms: CRex4
Genomic Target: kcnh6

Sequence: 5' AGGGCGCTCTACATTTCCAATGG 3'



Genomic Target tropicalis
Identities 23/23
genome
gRNA
5' CCATTGGAAATGTAGAGCGCCCT 3'
   |||||||||||||||||||||||
3' GGTAACCTTTACATCTCGCGGGA 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr9_10S:6277968..6277990 23/23 Antisense off-target XM_041578597.1
Chr9_10S:6277968..6277990 23/23 Antisense off-target XM_041578596.1
Chr9_10S:6277968..6277990 23/23 Antisense off-target XM_018238118.2
Chr9_10L:6823986..6824008 21/23 Antisense off-target XM_018234878.2
Chr9_10L:6823986..6824008 21/23 Antisense off-target XM_041576482.1
Chr9_10L:6823986..6824008 21/23 Antisense off-target XM_041576483.1
Chr9_10L:6823986..6824008 21/23 Antisense off-target XM_041576484.1
Chr9_10L:6823986..6824008 21/23 Antisense off-target XM_041576486.1
Chr9_10L:6823986..6824008 21/23 Antisense off-target XM_041576485.1
Chr8S:95479518..95479540 19/23 Sense unknown
Chr9_10S:77267089..77267111 19/23 Antisense unknown
tropicalis 10.0 Chr10:16465733..16465755 23/23 Sense target kcnh6
Chr9:29771273..29771295 19/23 Antisense off-target mafk
Chr2:120821000..120821022 19/23 Sense unknown
Publications
First: Membrane potential drives the exit from pluripotency and cell fate commitment via calcium and mTOR., Nat Commun 2022                                              
Most recent:
View All Papers