Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-25900619

gRNA Name: kcnh6 gRNA1
Synonyms: CRex3
Genomic Target: kcnh6

Sequence: 5' GGAATAAGGGGTGAAGACAGCGG 3'



Genomic Target tropicalis
Identities 23/23
genome
gRNA
5' CCGCTGTCTTCACCCCTTATTCC 3'
   |||||||||||||||||||||||
3' GGCGACAGAAGTGGGGAATAAGG 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr9_10L:6819849..6819871 21/23 Antisense off-target XM_041576486.1
Chr9_10L:6819849..6819871 21/23 Antisense off-target XM_041576485.1
Chr9_10S:6274520..6274542 21/23 Antisense off-target XM_041578596.1
Chr9_10S:6274520..6274542 21/23 Antisense off-target XM_018238118.2
Chr9_10S:6274520..6274542 21/23 Antisense off-target XM_041578597.1
Chr9_10L:6819849..6819871 21/23 Antisense off-target XM_018234878.2
Chr9_10L:6819849..6819871 21/23 Antisense off-target XM_041576482.1
Chr9_10L:6819849..6819871 21/23 Antisense off-target XM_041576483.1
Chr9_10L:6819849..6819871 21/23 Antisense off-target XM_041576484.1
Chr9_10L:23546806..23546828 19/23 Antisense unknown
tropicalis 10.0 Chr10:16468491..16468513 23/23 Sense target kcnh6
Chr3:59500138..59500160 20/23 Antisense off-target ptprb
Chr9:59566939..59566961 19/23 Sense off-target agap1
Chr4:123565683..123565705 19/23 Antisense off-target stimate
Chr3:6816469..6816491 19/23 Sense unknown
Chr4:93926303..93926325 19/23 Sense unknown
Publications
First: Membrane potential drives the exit from pluripotency and cell fate commitment via calcium and mTOR., Nat Commun 2022                                              
Most recent:
View All Papers