Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-25900473

gRNA Name: bop1 gRNA1
Synonyms:
Genomic Target: bop1

Sequence: 5' TGTACCTGTGCCCGCGCCAG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 20/20 20/20
genome
gRNA
5' CTGGCGCGGGCACAGGTACA 3'
   ||||||||||||||||||||
3' GACCGCGCCCGTGTCCATGT 5'
5' CTGGCGCGGGCACAGGTACA 3'
   ||||||||||||||||||||
3' GACCGCGCCCGTGTCCATGT 5'
5' CTGGCGCGGGCACAGGTACA 3'
   ||||||||||||||||||||
3' GACCGCGCCCGTGTCCATGT 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr6L:162764912..162764931 20/20 Sense target bop1.L
Chr6S:136030385..136030404 20/20 Antisense target bop1.S
Chr1S:95418679..95418698 19/20 Sense off-target safb.S
Chr2S:71395486..71395505 19/20 Antisense off-target cnr2.S
Chr1S:65010584..65010603 19/20 Antisense off-target bmpr1b.S
Chr8L:24719314..24719333 19/20 Sense off-target cav3.2.L
Chr6L:70280074..70280093 18/20 Antisense off-target sdha.L
Chr1L:38821842..38821861 18/20 Antisense off-target atp8a1.L
Chr2L:117466095..117466114 18/20 Antisense off-target inpp4a.L
Chr5L:52292598..52292617 18/20 Antisense off-target LOC121393667
Chr8L:33243748..33243767 18/20 Sense off-target LOC121397009
Chr1S:1169106..1169125 19/20 Sense unknown
Chr1S:183028282..183028301 19/20 Sense unknown
Chr2S:72427203..72427222 19/20 Sense unknown
Chr5S:62947674..62947693 18/20 Antisense unknown
Chr5S:76184092..76184111 18/20 Antisense unknown
Chr6L:87467544..87467563 18/20 Sense unknown
Chr7L:115413451..115413470 18/20 Antisense unknown
Chr5L:78892700..78892719 17/20 Antisense unknown
tropicalis 10.0 Chr6:152363221..152363240 20/20 Sense target bop1
Chr2:121689962..121689981 17/20 Antisense off-target mbnl2
Chr2:155516001..155516020 17/20 Sense off-target rpl21
Chr8:144270648..144270667 17/20 Sense off-target ints3
Chr1:38834751..38834770 16/20 Sense off-target tec
Chr1:38835080..38835099 16/20 Antisense off-target tec
Chr2:28361629..28361648 16/20 Sense off-target cmss1
Chr2:28361958..28361977 16/20 Antisense off-target cmss1
Chr4:47135239..47135258 16/20 Sense off-target prmt7
Chr4:47135568..47135587 16/20 Antisense off-target prmt7
Chr9:30958959..30958978 16/20 Sense off-target mad1l1
Chr9:30959198..30959217 16/20 Antisense off-target mad1l1
Chr2:28361629..28361648 16/20 Sense off-target filip1l
Chr2:28361958..28361977 16/20 Antisense off-target filip1l
Chr3:25292887..25292906 16/20 Antisense off-target slc25a48
Chr2:23071257..23071276 16/20 Sense off-target LOC116408666
Chr2:23071586..23071605 16/20 Antisense off-target LOC116408666
Chr4:112158232..112158251 16/20 Sense off-target LOC100492420
Chr4:112158561..112158580 16/20 Antisense off-target LOC100492420
Chr4:43683134..43683153 16/20 Antisense off-target LOC116410369
Chr8:123749245..123749264 16/20 Sense off-target LOC100498262
Chr8:123749574..123749593 16/20 Antisense off-target LOC100498262
Chr10:39110413..39110432 19/20 Sense unknown
Chr10:39123760..39123779 19/20 Sense unknown
Chr10:39136894..39136913 19/20 Sense unknown
Chr10:39179022..39179041 19/20 Sense unknown
Chr1:74993780..74993799 16/20 Sense unknown
Chr1:74994109..74994128 16/20 Antisense unknown
Chr1:75000532..75000551 16/20 Sense unknown
Chr1:75000861..75000880 16/20 Antisense unknown
Chr4:8158102..8158121 16/20 Sense unknown
Chr4:92581544..92581563 16/20 Antisense unknown
Chr5:30277675..30277694 16/20 Sense unknown
Chr5:30278004..30278023 16/20 Antisense unknown
Chr5:67815842..67815861 16/20 Antisense unknown
Chr5:89295187..89295206 16/20 Antisense unknown
Publications
First: Functions of block of proliferation 1 during anterior development in Xenopus laevis., PLoS One 2022                          
Most recent:
View All Papers