Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-25900338

gRNA Name: rapgef3 gRNA1
Synonyms:
Genomic Target: rapgef3

Sequence: 5' TGCGGAATCCCTGTGGTATG 3'



Genomic Target tropicalis laevis.L
Identities 20/20 19/20
genome
gRNA
5' CATACCACAGGGATTCCGCA 3'
   ||||||||||||||||||||
3' GTATGGTGTCCCTAAGGCGT 5'
5' CATACCAGAGGGATTCCGCA 3'
   ||||||| ||||||||||||
3' GTATGGTGTCCCTAAGGCGT 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr2L:152188072..152188091 19/20 Sense target rapgef3.L
Chr5L:60940678..60940697 17/20 Antisense unknown
tropicalis 10.0 Chr2:144384163..144384182 20/20 Sense rapgef3
Chr5:9476255..9476274 17/20 Sense
Publications
First: Identification and validation of candidate risk genes in endocytic vesicular trafficking associated with esophageal atresia and tracheoesophageal fistulas., HGG Adv 2022          
Most recent:
View All Papers