Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-25900334

gRNA Name: itsn1 gRNA3
Synonyms:
Genomic Target: itsn1

Sequence: 5' CATCTGGGCCATAACAGTGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 19/20 19/20
genome
gRNA
5' CCACTGTTATGGCCCAGATG 3'
   ||||||||||||||||||||
3' GGTGACAATACCGGGTCTAC 5'
5' CCACCGTTATGGCCCAGATG 3'
   |||| |||||||||||||||
3' GGTGACAATACCGGGTCTAC 5'
5' CCACCGTTATGGCCCAGATG 3'
   |||| |||||||||||||||
3' GGTGACAATACCGGGTCTAC 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr2L:13780303..13780322 19/20 Antisense target itsn1.L
Chr2S:20201468..20201487 19/20 Sense target itsn1.S
Chr2L:150641666..150641685 17/20 Antisense unknown
tropicalis 10.0 Chr2:14164959..14164978 20/20 Sense itsn1
Chr10:12017505..12017524 16/20 Antisense hoxb2
Publications
First: Identification and validation of candidate risk genes in endocytic vesicular trafficking associated with esophageal atresia and tracheoesophageal fistulas., HGG Adv 2022          
Most recent:
View All Papers