Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-25900332

gRNA Name: eftud2 gRNA2
Synonyms:
Genomic Target: eftud2

Sequence: 5' GGATGATCTGTCCCCCACCA 3'



Genomic Target tropicalis laevis.S
Identities 20/21 19/21
genome
gRNA
5' TGGTGGGGGACAGATCATCC 3'
   ||||||||||||||||||||
3' ACCACCCCCTGTCTAGTAGG 5'
5' CGGTGGGGGACAGATCATCC 3'
    |||||||||||||||||||
3' ACCACCCCCTGTCTAGTAGG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr9_10S:5280851..5280870 19/20 Sense target eftud2.S
Chr8L:27693366..27693385 18/20 Sense unknown
Chr8L:79361552..79361571 18/20 Antisense unknown
Chr1L:99673322..99673341 16/20 Antisense unknown
Chr1S:200997651..200997670 16/20 Antisense unknown
Chr8L:47140002..47140021 16/20 Sense unknown
tropicalis 10.0 Chr10:17885986..17886005 20/20 Antisense target eftud2
Chr3:80033682..80033701 18/20 Antisense off-target LOC108646168
Chr1:197013611..197013630 17/20 Antisense off-target rictor
Publications
First: Identification and validation of candidate risk genes in endocytic vesicular trafficking associated with esophageal atresia and tracheoesophageal fistulas., HGG Adv 2022          
Most recent:
View All Papers