Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-25900330

gRNA Name: disp1 gRNA1
Synonyms:
Genomic Target: disp1

Sequence: 5' TGGATGCCTTTCACACAATG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/21 19/21 19/21
genome
gRNA
5' CATTGTGTGAAAGGCATCCA 3'
   ||||||||||||||||||||
3' GTAACACACTTTCCGTAGGT 5'
5' CGTTGTGTGAAAGGCATCCA 3'
   | ||||||||||||||||||
3' GTAACACACTTTCCGTAGGT 5'
5' CATTATGTGAAAGGCATCCA 3'
   |||| |||||||||||||||
3' GTAACACACTTTCCGTAGGT 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr5L:16581661..16581680 19/20 Sense target disp1.L
Chr5S:13129072..13129091 19/20 Antisense target disp1.S
Chr8L:86836297..86836316 19/20 Sense off-target gng2.L
Chr7L:105060796..105060815 18/20 Antisense off-target LOC108696619
Chr7L:126269876..126269895 18/20 Antisense off-target LOC121395698
Chr7L:126753820..126753839 18/20 Antisense off-target LOC121395701
Chr2L:151186262..151186281 17/20 Sense off-target pfkm.L
Chr6L:26844411..26844430 17/20 Antisense off-target nebl.L
Chr2S:73099830..73099849 17/20 Antisense off-target clspn.S
Chr6S:79835047..79835066 17/20 Antisense off-target atxn1.S
Chr2L:48604888..48604907 17/20 Antisense off-target mettl16.L
Chr2S:30381027..30381046 17/20 Sense off-target LOC121400439
Chr2S:30519060..30519079 17/20 Antisense off-target LOC108705797
Chr6S:3417125..3417144 16/20 Antisense off-target map4.S
Chr9_10S:63894823..63894842 16/20 Antisense off-target fign.S
Chr3L:107431575..107431594 16/20 Sense off-target LOC108711385
Chr8S:31145732..31145751 16/20 Sense off-target LOC108699921
Chr7L:126690157..126690176 18/20 Antisense unknown
Chr2S:30220058..30220077 17/20 Antisense unknown
Chr2L:187757831..187757850 16/20 Antisense unknown
Chr3S:102767340..102767359 16/20 Antisense unknown
Chr5S:139909989..139910008 16/20 Antisense unknown
Chr7S:30715851..30715870 16/20 Sense unknown
tropicalis 10.0 Chr5:9523431..9523450 20/20 Antisense target disp1
Chr6:27635170..27635189 17/20 Sense off-target plxdc2
Chr6:87749372..87749391 17/20 Sense off-target serpinb4
Chr4:89313315..89313334 16/20 Antisense off-target ptprf
Chr1:20631244..20631263 19/20 Antisense unknown
Chr7:89886266..89886285 16/20 Sense unknown
Publications
First: Identification and validation of candidate risk genes in endocytic vesicular trafficking associated with esophageal atresia and tracheoesophageal fistulas., HGG Adv 2022          
Most recent:
View All Papers